Stem-loop sequence sme-mir-9a

AccessionMI0010788 (change log)
DescriptionSchmidtea mediterranea miR-9a stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --u  u   --au   c       ucu     uu     c   a     g   aa 
5'    ug uua    uga uauaugg   uuggu  ucuag ugu ugauu uaa  u
      || |||    ||| |||||||   |||||  ||||| ||| ||||| |||   
3'    ac agu    auu auauacu   aacca  agauc aca acuaa guu  u
   ucu  u   guau   -       -uu     uu     -   c     a   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2917: 42330-42434 [+]
intergenic
Database links

Mature sequence sme-miR-9a-5p

Accession MIMAT0011248
Previous IDssme-miR-9a
Sequence

21 - 

ucuuugguuuucuagcuguaugau

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-9a-3p

Accession MIMAT0012146
Previous IDssme-miR-9a*
Sequence

63 - 

cacacacuagauuaccaauuuc

 - 84

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).