Stem-loop sequence sme-mir-124d

AccessionMI0010778 (change log)
DescriptionSchmidtea mediterranea miR-124d stem-loop
Literature search

1 open access papers mention sme-mir-124d
(6 sentences)

Stem-loop
   ------uu   auau          aa       aa   a         a a 
5'         gga    guuuuaauaa  cauuuac  gcg gccuuaauu g a
           |||    ||||||||||  |||||||  ||| ||||||||| |  
3'         ccu    uaaaguuguu  gugaaug  cgc cggaauuaa c u
   ucuacuau   ----          gg       -g   a         - u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig791: 74189-74282 [-]
intergenic
Database links

Mature sequence sme-miR-124d-5p

Accession MIMAT0012137
Previous IDssme-miR-124d*
Sequence

20 - 

aacauuuacaagcgagccuuaau

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-124d-3p

Accession MIMAT0011238
Previous IDssme-miR-124d
Sequence

54 - 

uaaggcacgcgguaagugggu

 - 74

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).