Stem-loop sequence sme-mir-87d

AccessionMI0010775 (change log)
DescriptionSchmidtea mediterranea miR-87d stem-loop
Stem-loop
   --uuacauu          uau         u        -    ---        
5'          guuuuagaau   aaugucuua auuuugcu auua   ucauugu 
            ||||||||||   ||||||||| |||||||| ||||   |||||| u
3'          uaaaguuuua   uuacagaau ugaaacga uggu   aguaacu 
   uccuucuuu          uac         u        g    aaa        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig19991: 5071-5175 [+]
intergenic
Database links

Mature sequence sme-miR-87d-5p

Accession MIMAT0012136
Previous IDssme-miR-87d*
Sequence

21 - 

aaugucuuauauuuugcuauuauc

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-87d-3p

Accession MIMAT0011235
Previous IDssme-miR-87d
Sequence

63 - 

gugagcaaaguuuaagacauuc

 - 84

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).