Stem-loop sequence sme-mir-2149

AccessionMI0010769 (change log)
DescriptionSchmidtea mediterranea miR-2149 stem-loop
Stem-loop
   -gca      c  -a      c  c     -    a          ---a     
5'     gaagau aa  ugagua cg caaug acaa cuguugauga    gacu 
       |||||| ||  |||||| || ||||| |||| ||||||||||    ||| u
3'     cuuuug uu  auuuau gc guuac uguu gacgacuauu    cugu 
   gcua      c  cc      u  a     c    -          aaca     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig997: 5623-5724 [+]
intergenic
Database links

Mature sequence sme-miR-2149-5p

Accession MIMAT0011229
Sequence

21 - 

cgccaaugacaaacuguugau

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2149-3p

Accession MIMAT0012134
Sequence

60 - 

aucagcaguuguccauugacguu

 - 82

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).