Stem-loop sequence sme-let-7d

AccessionMI0010765 (change log)
DescriptionSchmidtea mediterranea let-7d stem-loop
Literature search

2 open access papers mention sme-let-7d
(9 sentences)

Stem-loop
   ---cuuccua  u      uac                         uuu 
5'           ua ucauuu   uagagguagugauucaaaaaguuaa   a
             || ||||||   |||||||||||||||||||||||||   a
3'           gu aguaaa   guuucuauuauuaaguuuuucaguu   c
   acuacagaaa  u      -ua                         uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig605: 55692-55790 [+]
intergenic
Database links

Mature sequence sme-let-7d

Accession MIMAT0011225
Sequence

21 - 

agagguagugauucaaaaaguu

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).