Stem-loop sequence sme-mir-10a

AccessionMI0010763 (change log)
DescriptionSchmidtea mediterranea miR-10a stem-loop
Literature search

1 open access papers mention sme-mir-10a
(1 sentences)

Stem-loop
   --uaauuu     c         -a     u    c      a  ug 
5'         guuuc uugauauaa  cccug agau cgaguu ga  g
           ||||| |||||||||  ||||| |||| |||||| ||  u
3'         uagag aauuauauu  ggggc ucua gcuuaa cu  u
   ucuucuau     u         aa     -    a      c  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3771: 5918-6010 [-]
intergenic
Database links

Mature sequence sme-miR-10a-5p

Accession MIMAT0011223
Sequence

21 - 

aacccuguagauccgaguuagau

 - 43

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-10a-3p

Accession MIMAT0012130
Sequence

52 - 

caauucgaaucucggggaauu

 - 72

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).