Stem-loop sequence mmu-mir-2137

AccessionMI0010750 (change log)
Symbol MGI:Mir2137
DescriptionMus musculus miR-2137 stem-loop
Literature search

6 open access papers mention mmu-mir-2137
(31 sentences)

Stem-loop
   gua   uac   --       cu  -        c 
5'    gua   cuc  cuuccug  gc cuuguugg u
      |||   |||  |||||||  || ||||||||  
3'    cgu   gag  gagggac  cg gggcggcc u
   ---   uac   au       cc  a        g 
Get sequence
Deep sequencing
8373 reads, 768 reads per million, 109 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 72992079-72992144 [+]
sense
OTTMUST00000042872 ; Zfp185-001; intron 1
OTTMUST00000043010 ; Zfp185-002; intron 1
ENSMUST00000114546 ; Zfp185-001; intron 1
ENSMUST00000134588 ; Zfp185-002; intron 1
ENSMUST00000164800 ; Zfp185-201; intron 1
Database links

Mature sequence mmu-miR-2137

Accession MIMAT0011213
Sequence

35 - 

gccggcgggagccccagggag

 - 55

Get sequence
Deep sequencing8347 reads, 100 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19351399 "Identification and characterization of new miRNAs cloned from normal mouse mammary gland" Sdassi N, Silveri L, Laubier J, Tilly G, Costa J, Layani S, Vilotte JL, Le Provost F BMC Genomics. 10:149(2009).