Stem-loop sequence mmu-mir-2136

AccessionMI0010749 (change log)
Symbol MGI:Mir2136
DescriptionMus musculus miR-2136 stem-loop
Stem-loop
   ---      auc       g g    --    -ga  uuu 
5'    ccgcgu   cagucag a ucag  uuag   ag   u
      ||||||   ||||||| | ||||  ||||   ||    
3'    ggugua   gucaguu u gguc  aauu   uc   a
   ggu      -ga       g g    uu    aag  uga 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 104426113-104426187 [+]
intergenic
Database links

Mature sequence mmu-miR-2136

Accession MIMAT0011212
Sequence

51 - 

cuggguguugacugagaugug

 - 71

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19351399 "Identification and characterization of new miRNAs cloned from normal mouse mammary gland" Sdassi N, Silveri L, Laubier J, Tilly G, Costa J, Layani S, Vilotte JL, Le Provost F BMC Genomics. 10:149(2009).