Stem-loop sequence gma-MIR172e

AccessionMI0010729 (change log)
DescriptionGlycine max miR172e stem-loop
Gene family MIPF0000035; MIR172
Literature search

28 open access papers mention gma-MIR172e
(122 sentences)

Stem-loop
   aaaac     cugu    c g  g                a  -   uuu       au     u     a   g ucc 
5'      aguca    uugc g ug agcaucaucaagauuc ca agc   agggggc  uaauu guuug ggu g   c
        |||||    |||| | || |||||||||||||||| || |||   |||||||  ||||| ||||| ||| |    
3'      ucagu    aacg c ac ucguaguaguucuaag gu ucg   uuucccg  auuaa caaac cua u   u
   -auaa     aaau    a g  g                g  a   --u       --     c     -   g uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 31482550-31482702 [-]
intergenic
Database links

Mature sequence gma-miR172e

Accession MIMAT0011200
Sequence

114 - 

ggaaucuugaugaugcugcagcag

 - 137

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).