Stem-loop sequence gma-MIR172d

AccessionMI0010728 (change log)
DescriptionGlycine max miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

29 open access papers mention gma-MIR172d
(124 sentences)

Stem-loop
   aaaac     cug     aga  g                a  agcu    -      --  ug      - ug  c 
5'      agucg   auugc   ug agcaucaucaagauuc ca    ucag ggguuu  uu  uuuggg g  gu c
        |||||   |||||   || |||||||||||||||| ||    |||| ||||||  ||  |||||| |  || c
3'      ucagc   uaacg   ac ucguaguaguucuaag gu    aguu cccgaa  aa  aaaccc c  ua u
   -acaa     aaa     acg  g                g  --au    u      uu  gu      u gu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 5659819-5659968 [+]
intergenic
Database links

Mature sequence gma-miR172d

Accession MIMAT0011199
Sequence

111 - 

ggaaucuugaugaugcugcagcag

 - 134

Get sequence
Evidence experimental; cloned [1], Northern [1], SOLiD [2]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2