Stem-loop sequence gma-MIR172c

AccessionMI0010727 (change log)
DescriptionGlycine max miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

36 open access papers mention gma-MIR172c
(232 sentences)

Stem-loop
   aaauc     cugu    c g  g                a  -   uuu      au     -ug    ag ug  u 
5'      aguca    uugc g ug agcaucaucaagauuc ca agc   aggggc  uaauu   uuug  g  gu c
        |||||    |||| | || |||||||||||||||| || |||   ||||||  |||||   ||||  |  || c
3'      ucagu    aacg c ac ucguaguaguucuaag gu ucg   uucccg  auuaa   aaac  c  ua u
   -auaa     aaau    a g  g                g  a   -uu      --     cca    cu gu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 2979182-2979334 [+]
intergenic
Database links

Mature sequence gma-miR172c

Accession MIMAT0011198
Sequence

114 - 

ggaaucuugaugaugcugcag

 - 134

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).