Stem-loop sequence gma-MIR167f

AccessionMI0010726 (change log)
DescriptionGlycine max miR167f stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

26 open access papers mention gma-MIR167f
(187 sentences)

Stem-loop
         -a  ----     c  u           g        uaa   c  u  c 
5' ucaugc  cc    acuac ag ugaagcugcca caugaucu   cuu cc ca u
   ||||||  ||    ||||| || ||||||||||| ||||||||   ||| || || u
3' aguacg  gg    ugaug uc acuuugacggu guacuaga   gaa gg gu g
         cc  uugu     a  c           -        cua   a  u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 47144841-47144949 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR167f
gma-MIR167hchr10: 47144854-47144942 [+]
gma-MIR167fchr10: 47144841-47144949 [-]
Database links

Mature sequence gma-miR167f

Accession MIMAT0011197
Sequence

19 - 

ugaagcugccagcaugaucuu

 - 39

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).