Stem-loop sequence gma-MIR167e

AccessionMI0010725 (change log)
DescriptionGlycine max miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

26 open access papers mention gma-MIR167e
(195 sentences)

Stem-loop
         -a  ----     c  u           g        uaa   c  u ac 
5' ucaugc  cc    acuac ag ugaagcugcca caugaucu   cuu cc c  u
   ||||||  ||    ||||| || ||||||||||| ||||||||   ||| || |  u
3' aguacg  gg    ugaug uc acuuugacggu guacuaga   gaa gg g  g
         cc  ucgu     a  c           -        cua   a  u cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 39002092-39002200 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR167e
gma-MIR167ichr20: 39002038-39002188 [-]
gma-MIR167echr20: 39002092-39002200 [+]
Database links

Mature sequence gma-miR167e

Accession MIMAT0011196
Sequence

19 - 

ugaagcugccagcaugaucuu

 - 39

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2], 454 [3]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).