Stem-loop sequence osa-MIR2121a

AccessionMI0010709 (change log)
DescriptionOryza sativa miR2121a stem-loop
Gene family MIPF0000765; MIR2121
Literature search

1 open access papers mention osa-MIR2121a
(1 sentences)

Stem-loop
   --        cu                     aacacagccgcggccuuaggcuguguu 
5'   gugcuaau  aucgcuccguuuuccgugcgg                           c
     ||||||||  |||||||||||||||||||||                            
3'   cgcgauua  uggcgaggcaaaaggcacguc                           c
   ug        cc                     cccuuuacucaaggguagaccaucuac 
Get sequence
Deep sequencing
459 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Huang et al. incorrectly named this sequence miR602 in [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 16373428-16373547 [+]
intergenic
Database links

Mature sequence osa-miR2121a

Accession MIMAT0011180
Sequence

96 - 

aaaacggagcgguccauuagcgcg

 - 119

Get sequence
Deep sequencing441 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:19081140 "Heavy metal-regulated new microRNAs from rice" Huang SQ, Peng J, Qiu CX, Yang ZM J Inorg Biochem. 103:282-287(2009).