Stem-loop sequence osa-MIR2120

AccessionMI0010708 (change log)
DescriptionOryza sativa miR2120 stem-loop
Literature search

2 open access papers mention osa-MIR2120
(2 sentences)

Stem-loop
   --                   ---a    gaua    u 
5'   aacaaccgggacuaaagau    ucuu    ucuu a
     |||||||||||||||||||    ||||    |||| a
3'   uuguuggcccugauuucua    agaa    aggg c
   uc                   gaaa    -aug    c 
Get sequence
Deep sequencing
466 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Huang et al. incorrectly named this sequence miR601 in [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 22733773-22733845 [+]
intergenic
Database links

Mature sequence osa-miR2120

Accession MIMAT0011179
Sequence

49 - 

aaagaucuuuagucccgguuguuc

 - 72

Get sequence
Deep sequencing132 reads, 2 experiments
Evidence experimental; cloned [1]

References

1
PMID:19081140 "Heavy metal-regulated new microRNAs from rice" Huang SQ, Peng J, Qiu CX, Yang ZM J Inorg Biochem. 103:282-287(2009).