Stem-loop sequence mdm-MIR482a

AccessionMI0010695 (change log)
Previous IDsmdm-MIR482
DescriptionMalus domestica miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

4 open access papers mention mdm-MIR482a
(10 sentences)

Stem-loop
       --a            gauu     u          u           -u            rgaaaa        au 
5' gaga   gagggaaaggga    ggagc gcuggaaguu uaggaaugggc  guuugggaagaa      uuacaaga  a
   ||||   ||||||||||||    ||||| |||||||||| |||||||||||  ||||||||||||      ||||||||  a
3' cucu   uucccuuucccu    ccuug cgaccuuuag auccuuacccg  cgaacccuucuu      gguguucu  u
       aug            ----     u          u           cc            ---ugg        gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC002407.840: 1569-1723 [+]
intergenic
Database links

Mature sequence mdm-miR482a-5p

Accession MIMAT0011164
Previous IDsmdm-miR482*
Sequence

40 - 

aggaaugggcuguuugggaaga

 - 61

Get sequence
Evidence not experimental

Mature sequence mdm-miR482a-3p

Accession MIMAT0011165
Previous IDsmdm-miR482
Sequence

98 - 

uucccaagcccgcccauuccua

 - 119

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).
2
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).