Stem-loop sequence ssc-mir-30a

AccessionMI0010688 (change log)
DescriptionSus scrofa miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

24 open access papers mention ssc-mir-30a
(59 sentences)

Stem-loop
      --c    ----a    ga                uc           -  gagg 
5' ucc   ugcg     cagu  gcggcuguaaacaucc  gacuggaagcu gu    c
   |||   ||||     ||||  ||||||||||||||||  ||||||||||| ||     
3' agg   acgc     guca  cgccgacguuuguagg  cugacuuucgg ca    u
      acu    ccucc    gc                --           g  gaag 
Get sequence
Deep sequencing
70898 reads, 1.5e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 57750736-57750842 [-]
intergenic
chrUScaf3160: 200546-200652 [+]
intergenic
Database links

Mature sequence ssc-miR-30a-5p

Accession MIMAT0010193
Previous IDsssc-miR-30a
Sequence

21 - 

uguaaacauccucgacuggaag

 - 42

Get sequence
Deep sequencing69253 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2,4-5], cloned [3]

Mature sequence ssc-miR-30a-3p

Accession MIMAT0015300
Sequence

62 - 

cuuucagucggauguuugcagc

 - 83

Get sequence
Deep sequencing1645 reads, 15 experiments
Evidence experimental; Illumina [2,4-5]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).