Stem-loop sequence ssc-mir-215

AccessionMI0010687 (change log)
DescriptionSus scrofa miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

13 open access papers mention ssc-mir-215
(57 sentences)

Stem-loop
   -ag   u           a a  a     -   u         -  gug 
5'    aga gguguacagga a ug ccuau gaa ugacagaca au   g
      ||| ||||||||||| | || ||||| ||| ||||||||| ||    
3'    ucu cuauaugucuu u ac ggaug cuu acugucugu ua   c
   ucg   -           a a  c     u   u         c  aau 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 11786567-11786662 [-]
antisense
chr10: 11963149-11963244 [+]
antisense
Clustered miRNAs
< 10kb from ssc-mir-215
ssc-mir-215chr10: 11963149-11963244 [+]
ssc-mir-194bchr10: 11962863-11962940 [+]
ssc-mir-194bchr10: 11786871-11786948 [-]
ssc-mir-215chr10: 11786567-11786662 [-]
Database links

Mature sequence ssc-miR-215

Accession MIMAT0010192
Sequence

20 - 

augaccuaugaauugacagac

 - 40

Get sequence
Deep sequencing9 reads, 5 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).