Stem-loop sequence ssc-mir-181a-1

AccessionMI0010686 (change log)
Previous IDsssc-mir-181a
DescriptionSus scrofa miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

33 open access papers mention ssc-mir-181a-1
(176 sentences)

Stem-loop
        ua  -     -  uc  u a   u      cu       a    g  au 
5' gaguu  ga gguug cu  ag g aca ucaacg  gucggug guuu ga  u
   |||||  || ||||| ||  || | ||| ||||||  ||||||| |||| ||  c
3' cucga  cu ccaac gg  uc c ugu aguugc  cagcuac caaa cu  a
        --  a     c  ua  c a   u      --       -    a  aa 
Get sequence
Deep sequencing
45907 reads, 1.47e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 26427018-26427121 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-181a-1
ssc-mir-181a-1chr10: 26427018-26427121 [-]
ssc-mir-181b-1chr10: 26426857-26426936 [-]
Database links

Mature sequence ssc-miR-181a

Accession MIMAT0010191
Sequence

23 - 

aacauucaacgcugucggugaguu

 - 46

Get sequence
Deep sequencing86411 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).