Stem-loop sequence ssc-mir-450a

AccessionMI0010683 (change log)
Previous IDsssc-mir-450
DescriptionSus scrofa miR-450a stem-loop
Gene family MIPF0000128; mir-450
Literature search

4 open access papers mention ssc-mir-450a
(4 sentences)

Stem-loop
         caa  aaa     u      -  uu     u              cag 
5' gucugu   ag   gaugc aaacug gu  ugcga guguuccuaauaug   u
   ||||||   ||   ||||| |||||| ||  ||||| ||||||||||||||   a
3' uagaca   uc   cuaug uuuggu cg  acguu uacgaggguuauau   u
         -ua  --a     u      a  -u     u              aaa 
Get sequence
Deep sequencing
6169 reads, 667 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf3177: 4173-4278 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-450a
ssc-mir-542chrUScaf3177: 3348-3427 [+]
ssc-mir-450cchrUScaf3177: 4053-4133 [+]
ssc-mir-450achrUScaf3177: 4173-4278 [+]
ssc-mir-450bchrUScaf3177: 4358-4437 [+]
Database links

Mature sequence ssc-miR-450a

Accession MIMAT0010188
Previous IDsssc-miR-450
Sequence

28 - 

uuuugcgauguguuccuaauau

 - 49

Get sequence
Deep sequencing6163 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2-3]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).