Stem-loop sequence ssc-mir-133a-1

AccessionMI0010681 (change log)
Previous IDsssc-mir-133a
DescriptionSus scrofa miR-133a-1 stem-loop
Gene family MIPF0000029; mir-133
Literature search

40 open access papers mention ssc-mir-133a-1
(187 sentences)

Stem-loop
      - accca     uuu    a       aa  u  a        aacug 
5' cgg g     aaugc   gcua agcuggu  aa gg accaaauc     u
   ||| |     |||||   |||| |||||||  || || ||||||||      
3' gcc c     uuacg   cgau ucgacca  uu cc ugguuuag     u
      g gacag     cgu    g       ac  c  c        guaag 
Get sequence
Deep sequencing
624 reads, 76.9 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 69274653-69274755 [-]
intergenic
Database links

Mature sequence ssc-miR-133a-5p

Accession MIMAT0015299
Previous IDsssc-miR-133a*
Sequence

23 - 

agcugguaaaauggaaccaaau

 - 44

Get sequence
Deep sequencing30 reads, 9 experiments
Evidence experimental; cloned [3], Illumina [4]

Mature sequence ssc-miR-133a-3p

Accession MIMAT0010186
Previous IDsssc-miR-133a
Sequence

61 - 

uugguccccuucaaccagcug

 - 81

Get sequence
Deep sequencing1226 reads, 13 experiments
Evidence experimental; Illumina [5]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).