Stem-loop sequence ssc-mir-101-1

AccessionMI0010678 (change log)
Previous IDsssc-mir-101a-1
DescriptionSus scrofa miR-101-1 stem-loop
Gene family MIPF0000046; mir-101
Literature search

12 open access papers mention ssc-mir-101-1
(26 sentences)

Stem-loop
   gac  -a  ug  c                    c a    guaua 
5'    ug  ac  uc uuuuucgguuaucaugguac g ugcu     u
      ||  ||  || |||||||||||||||||||| | ||||      
3'    ac  ug  gg aagaagucaauagugucaug c augg     c
   -cu  cg  gu  u                    a -    aaagu 
Get sequence
Deep sequencing
76241 reads, 1.55e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 242988419-242988509 [-]
sense
ENSSSCT00000005750 ; RCL1-201; intron 8
Database links

Mature sequence ssc-miR-101

Accession MIMAT0010185
Previous IDsssc-miR-101a
Sequence

55 - 

uacaguacugugauaacugaa

 - 75

Get sequence
Deep sequencing152273 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2,4-5], cloned [3]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).