Stem-loop sequence sja-mir-71a

AccessionMI0010669 (change log)
Previous IDssja-mir-71
DescriptionSchistosoma japonicum miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

16 open access papers mention sja-mir-71a
(99 sentences)

Stem-loop
        a  ag     u     a  au  u          c 
5' gugau cu  ugcug gaaag cg  gg agugagaugc a
   ||||| ||  ||||| ||||| ||  || |||||||||| g
3' cacua ga  auggc cuuuc gc  cc ucgcucuacg u
        a  --     c     c  -c  u          u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007682.1: 3056-3135 [-]
intergenic
Clustered miRNAs
< 10kb from sja-mir-71a
sja-mir-71aCABF01007682.1: 3056-3135 [-]
sja-mir-2aCABF01007682.1: 2964-3041 [-]
sja-mir-2bCABF01007682.1: 2869-2946 [-]
sja-mir-2eCABF01007682.1: 2769-2851 [-]
Database links

Mature sequence sja-miR-71a

Accession MIMAT0010176
Previous IDssja-miR-71
Sequence

16 - 

ugaaagacgaugguagugaga

 - 36

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).