Stem-loop sequence bol-MIR172a

AccessionMI0010665 (change log)
DescriptionBrassica oleracea miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

9 open access papers mention bol-MIR172a
(78 sentences)

Stem-loop
       uu    a gc      c           a    gaa  uga     cu      u 
5' cguu  uugu g  gcagca caucaagauuc caug   au   aaaau  ccuaau u
   ||||  |||| |  |||||| ||||||||||| ||||   ||   |||||  |||||| u
3' gcag  aaca c  cgucgu guaguucuaag guau   ua   uuuug  ggauua u
       cc    a ua      a           a    aug  uag     --      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bol-miR172a

Accession MIMAT0010171
Sequence

87 - 

agaaucuugaugaugcugcau

 - 107

Get sequence
Evidence by similarity; MI0010661

References

1