Stem-loop sequence bol-MIR171a

AccessionMI0010664 (change log)
DescriptionBrassica oleracea miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention bol-MIR171a
(11 sentences)

Stem-loop
      aug  a        ug             -aau  aca    uuu 
5' aca   cg gauauugg  cgguucaaucaga    cc   cucu   g
   |||   || ||||||||  |||||||||||||    ||   ||||    
3' ugu   gc cuauaacc  gccgaguuaguuu    gg   gaga   u
      -ga  a        gu             guuu  cua    ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bol-miR171a

Accession MIMAT0010170
Sequence

71 - 

uugagccgugccaauaucacg

 - 91

Get sequence
Evidence by similarity; MI0010656

References

1