Stem-loop sequence bol-MIR157a

AccessionMI0010663 (change log)
DescriptionBrassica oleracea miR157a stem-loop
Gene family MIPF0000008; MIR156
Literature search

7 open access papers mention bol-MIR157a
(18 sentences)

Stem-loop
      u           -           u     --u  c    a   acaagga 
5' ggu guugacagaag auagagagcac aagga   ga augc agu       u
   ||| ||||||||||| ||||||||||| |||||   || |||| |||        
3' cca uaacugucuuc uaucucucgug uuucu   uu uacg uua       a
      -           a           u     cau  c    c   aaggaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bol-miR157a

Accession MIMAT0010169
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence by similarity; MI0010648

References

1