Stem-loop sequence bra-MIR172b

AccessionMI0010662 (change log)
DescriptionBrassica rapa miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

14 open access papers mention bra-MIR172b
(50 sentences)

Stem-loop
   u  a         c           a    -gaaau g   aa         ua 
5'  gu ggugcagca cauuaagauuc caug      u aga  acccuaauu  u
    || ||||||||| ||||||||||| ||||      | |||  |||||||||   
3'  ca cuacgucgu guaguucuaag guau      a ucu  ugggauuaa  a
   a  a         a           a    auguau g   --         uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bra-miR172b-5p

Accession MIMAT0010167
Previous IDsbra-miR172b*
Sequence

8 - 

gcagcaccauuaagauucaca

 - 28

Get sequence
Evidence experimental; cloned [1], Northern [1]

Mature sequence bra-miR172b-3p

Accession MIMAT0010168
Previous IDsbra-miR172b
Sequence

82 - 

agaaucuugaugaugcugcau

 - 102

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1