Stem-loop sequence bra-MIR172a

Accession

MI0010661

Description

Brassica rapa miR172a stem-loop

Gene family

MIPF0000035; MIR172

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

    uu    a gc      c           a    gaa  uga     cu      u 
cguu  uugu g  gcagca caucaagauuc caug   au   aaaau  ccuaau u
||||  |||| |  |||||| ||||||||||| ||||   ||   |||||  |||||| u
gcag  aaca c  cgucgu guaguucuaag guau   ua   uuuug  ggauua u
    cc    a ua      a           a    aug  uag     --      a 

Mature sequence bra-miR172a

• Accession: MIMAT0010166
• Sequence: 87 - agaaucuugaugaugcugcau - 107
• Evidence: experimental; cloned [1], Northern [1]

References

1. PMID:18558089 "Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica" He XF, Fang YY, Feng L, Guo HS FEBS Lett. 582:2445-2452(2008).