Stem-loop sequence bra-MIR171e

AccessionMI0010660 (change log)
DescriptionBrassica rapa miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention bra-MIR171e
(13 sentences)

Stem-loop
       a    uc  cuuu         c       c      --  ucc   uuacacacg 
5' acga agag  cu    gauauuggc ugguuca ucagau  cu   aga         u
   |||| ||||  ||    ||||||||| ||||||| ||||||  ||   |||         a
3' ugcu ucuc  ga    cuauaaccg gccgagu agucua  ga   ucu         c
       c    gu  --cu         c       u      uu  cuc   uacauauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 21911195-21911313 [+]
intergenic
Database links

Mature sequence bra-miR171e

Accession MIMAT0010165
Sequence

84 - 

ugauugagccgcgccaauauc

 - 104

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
2