Stem-loop sequence bra-MIR171d

AccessionMI0010659 (change log)
DescriptionBrassica rapa miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention bra-MIR171d
(10 sentences)

Stem-loop
      -a     a      a ug          a     --   ugu    acu 
5' ggu  acgcg gauauu g  cgguucaauc aauag  ucg   ucuc   u
   |||  ||||| |||||| |  |||||||||| |||||  |||   ||||    
3' cca  ugcgc cuauaa c  gccgaguuag uuguu  ggc   agag   g
      ac     a      c gu          c     uu   --u    aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 4092008-4092108 [-]
intergenic
Database links

Mature sequence bra-miR171d

Accession MIMAT0010164
Sequence

73 - 

uugagccgugccaauaucacg

 - 93

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1