Stem-loop sequence bra-MIR171c

AccessionMI0010658 (change log)
DescriptionBrassica rapa miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention bra-MIR171c
(10 sentences)

Stem-loop
      a      a ug          a     --   ua    uag 
5' gcg gauauu g  cgguucaauc aauag  ucg  cucu   c
   ||| |||||| |  |||||||||| |||||  |||  ||||    
3' cgc cuauaa c  gccgaguuag uuguu  ggc  gaga   u
      a      c gu          c     uu   ua    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 20120996-20121083 [+]
intergenic
Database links

Mature sequence bra-miR171c

Accession MIMAT0010163
Sequence

67 - 

uugagccgugccaauaucacg

 - 87

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1