Stem-loop sequence bra-MIR171b

AccessionMI0010657 (change log)
DescriptionBrassica rapa miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention bra-MIR171b
(12 sentences)

Stem-loop
   u   --caa   a      a ug          a     uc   c    agu 
5'  ggu     gcg gauauu g  cgguucaauc aauag  uca ucuu   u
    |||     ||| |||||| |  |||||||||| |||||  ||| ||||    
3'  cca     cgc cuauaa c  gccgaguuag uuguu  agu agag   g
   a   auaua   a      c gu          c     uu   u    aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 34811767-34811870 [+]
intergenic
Database links

Mature sequence bra-miR171b

Accession MIMAT0010162
Sequence

74 - 

uugagccgugccaauaucacg

 - 94

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
2