Stem-loop sequence bra-MIR171a

AccessionMI0010656 (change log)
DescriptionBrassica rapa miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention bra-MIR171a
(10 sentences)

Stem-loop
     a        ug             -     aca    uuu 
5' cg gauauugg  ugguucaaucaga aaacc   cucu   g
   || ||||||||  ||||||||||||| |||||   ||||    
3' gc cuauaacc  gccgaguuaguuu uuugg   gaga   u
     a        gu             g     cua    ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 22648705-22648789 [-]
intergenic
Database links

Mature sequence bra-miR171a

Accession MIMAT0010161
Sequence

65 - 

uugagccgugccaauaucacg

 - 85

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1