Stem-loop sequence bra-MIR167d

AccessionMI0010655 (change log)
DescriptionBrassica rapa miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

9 open access papers mention bra-MIR167d
(36 sentences)

Stem-loop
       cac   -  u u a         c               --u   ---     c        
5' ggcg   cgg ca c g ugaagcugc agcaugaucuaauua   cuu   ucuuu ucuguug 
   ||||   ||| || | | ||||||||| |||||||||||||||   |||   ||||| |||||| a
3' ccgc   guc gu g c acuuugacg uuguacuagauuagu   gag   agaaa agguagc 
       ucu   a  u c c         c               ugu   uac     -        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bra-miR167d

Accession MIMAT0010160
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1