Stem-loop sequence bra-MIR167c

AccessionMI0010654 (change log)
DescriptionBrassica rapa miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

9 open access papers mention bra-MIR167c
(36 sentences)

Stem-loop
        -    g  ucu a         c             ua  u   uu     guuga      g 
5' ggugu acag ca   g ugaagcugc agcaugaucuaau  ac uuc  ucucu     uuuuau a
   ||||| |||| ||   | ||||||||| |||||||||||||  || |||  |||||     ||||||  
3' ccacg uguc gu   c acuuugacg uuguacuagauua  ug gag  agaga     aaggua c
        c    a  uac c         c             gc  u   -u     ----a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bra-miR167c

Accession MIMAT0010159
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1