Stem-loop sequence bra-MIR167a

AccessionMI0010652 (change log)
DescriptionBrassica rapa miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

9 open access papers mention bra-MIR167a
(36 sentences)

Stem-loop
        ac   -  u u a         c             ua  -     uu ---         ua 
5' ggugc  cgg ca c g ugaagcugc agcaugaucuagu  ac uuuau  c   uccguuguu  u
   |||||  ||| || | | ||||||||| |||||||||||||  || |||||  |   |||||||||  c
3' cuacg  guc gu g c acuuugaug uuguacuagauua  ug gaaua  g   agguaacag  c
        cu   a  u c c         c             gc  u     gg aaa         ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 19161779-19161912 [+]
intergenic
Database links

Mature sequence bra-miR167a

Accession MIMAT0010157
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1