Stem-loop sequence bra-MIR164a

AccessionMI0010651 (change log)
DescriptionBrassica rapa miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

12 open access papers mention bra-MIR164a
(29 sentences)

Stem-loop
   c   cac       a  ca             ccaacaa   c    u 
5'  cuc   guuggag ag  gggcacgugcaaa       aca gaga c
    |||   ||||||| ||  |||||||||||||       ||| ||||  
3'  gag   caaccuc uc  cucgugcacguuu       ugu cucu u
   c   -ua       c  ac             -----aa   a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA5: 150875-150966 [-]
intergenic
Database links

Mature sequence bra-miR164a

Accession MIMAT0010156
Sequence

10 - 

uggagaagcagggcacgugca

 - 30

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
2