Stem-loop sequence bra-MIR160a

AccessionMI0010650 (change log)
DescriptionBrassica rapa miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

8 open access papers mention bra-MIR160a
(32 sentences)

Stem-loop
   ua       u      a  ugu      c       cu         c u ua  c         
5'   uguguag uguaua ga   guaugc uggcucc  guaugccau c c  ag ucaucgac 
     ||||||| |||||| ||   |||||| |||||||  ||||||||| | |  || ||||||| c
3'   auacauu acauau cu   uauacg accgagg  uaugcggua g g  uc aguaguua 
   -c       u      a  -uu      u       ag         a u cc  c         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA5: 3222211-3222337 [-]
intergenic
Database links

Mature sequence bra-miR160a-5p

Accession MIMAT0010154
Previous IDsbra-miR160a
Sequence

26 - 

ugccuggcucccuguaugcca

 - 46

Get sequence
Evidence experimental; cloned [1], Northern [1]

Mature sequence bra-miR160a-3p

Accession MIMAT0010155
Previous IDsbra-miR160a*
Sequence

86 - 

gcguaugaggagccaugcaua

 - 106

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1