Stem-loop sequence bra-MIR159a

AccessionMI0010649 (change log)
DescriptionBrassica rapa miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

9 open access papers mention bra-MIR159a
(52 sentences)

Stem-loop
   aa            a         c      -uu    ------      aga      g  a  c    a uc     -    cu       aua 
5'   guagggcuccuu uaguucaaa gagagu   agca      ggguaa   aaagcu cu ag uaug a  ccaua agcc  aauccuu   u
     |||||||||||| ||||||||| ||||||   ||||      ||||||   |||||| || || |||| |  ||||| ||||  |||||||   a
3'   caucucgaggga guuagguuu uucuca   ucgu      cccguu   uuucga ga uc auac u  gguau uugg  uuaggaa   u
   -a            a         c      uuu    uaauuu      caa      g  c  u    a uc     a    -u       aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA7: 15273666-15273850 [+]
intergenic
Database links

Mature sequence bra-miR159a

Accession MIMAT0010153
Sequence

163 - 

uuuggauugaagggagcucua

 - 183

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1