Stem-loop sequence bra-MIR157a

Accession

MI0010648

Description

Brassica rapa miR157a stem-loop

Gene family

MIPF0000008; MIR156

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Stem-loop

      c    uguu        -           u     --u        a  aca   gua    -     a   c 
gugaug uggu    gacagaag auagagagcac aagga   gacaugca gu   uau   ugua ucauc cac g
|||||| ||||    |||||||| ||||||||||| |||||   |||||||| ||   |||   |||| ||||| ||| c
uauuac acca    cugucuuc uaucucucgug uuucu   cuguacgu cg   aua   acau aguag gug c
      c    ----        a           c     cau        c  ---   aaa    u     -   u 

Mature sequence bra-miR157a

• Accession: MIMAT0010152
• Sequence: 14 - uugacagaagauagagagcac - 34
• Evidence: experimental; cloned [1], Northern [1]

References

1. PMID:18558089 "Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica" He XF, Fang YY, Feng L, Guo HS FEBS Lett. 582:2445-2452(2008).