Stem-loop sequence bra-MIR157a

AccessionMI0010648 (change log)
DescriptionBrassica rapa miR157a stem-loop
Gene family MIPF0000008; MIR156
Literature search

7 open access papers mention bra-MIR157a
(41 sentences)

Stem-loop
         c    uguu        -           u     --u        a  aca   gua    -     a   c 
5' gugaug uggu    gacagaag auagagagcac aagga   gacaugca gu   uau   ugua ucauc cac g
   |||||| ||||    |||||||| ||||||||||| |||||   |||||||| ||   |||   |||| ||||| ||| c
3' uauuac acca    cugucuuc uaucucucgug uuucu   cuguacgu cg   aua   acau aguag gug c
         c    ----        a           c     cau        c  ---   aaa    u     -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bra-miR157a

Accession MIMAT0010152
Sequence

14 - 

uugacagaagauagagagcac

 - 34

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
2