Stem-loop sequence lmi-mir-9a

AccessionMI0010645 (change log)
DescriptionLocusta migratoria miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention lmi-mir-9a
(2 sentences)

Stem-loop
   --u       u        g     -gu  a 
5'    cuuuggu aucuagcu uauga   gc u
      ||||||| |||||||| |||||   ||  
3'    gaagcca uggaucga auacu   ug g
   auu       u        a     guc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lmi-miR-9a-5p

Accession MIMAT0010146
Previous IDslmi-miR-9a
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lmi-miR-9a-3p

Accession MIMAT0010147
Previous IDslmi-miR-9a*
Sequence

39 - 

auaaagcuagguuaccgaaguua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1