Stem-loop sequence lmi-mir-10

AccessionMI0010644 (change log)
DescriptionLocusta migratoria miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention lmi-mir-10
(4 sentences)

Stem-loop
   -u   -  g    u           ug    
5'   acc cu uaga ccgaauuuguu  aca 
     ||| || |||| |||||||||||  || u
3'   ugg ga aucu ggcuuaaacag  uga 
   uu   a  g    u           cg    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lmi-miR-10-5p

Accession MIMAT0010144
Previous IDslmi-miR-10
Sequence

1 - 

uacccuguagauccgaauuugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lmi-miR-10-3p

Accession MIMAT0010145
Previous IDslmi-miR-10*
Sequence

38 - 

aaauucgguucuagagagguuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1