Stem-loop sequence lmi-mir-210

AccessionMI0010643 (change log)
DescriptionLocusta migratoria miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

2 open access papers mention lmi-mir-210
(2 sentences)

Stem-loop
   --        -g    u        uuag gau 
5'   agcugcug  acac gcacaaga    c   u
     ||||||||  |||| ||||||||    |    
3'   ucggcgac  ugug cguguucu    g   a
   ua        ag    -        --ca aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lmi-miR-210-5p

Accession MIMAT0010142
Previous IDslmi-miR-210*
Sequence

1 - 

agcugcuggacacugcacaaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lmi-miR-210-3p

Accession MIMAT0010143
Previous IDslmi-miR-210
Sequence

40 - 

cuugugcgugugacagcggcuau

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1