Stem-loop sequence lmi-mir-276

AccessionMI0010641 (change log)
DescriptionLocusta migratoria miR-276 stem-loop
Gene family MIPF0000124; mir-276
Literature search

2 open access papers mention lmi-mir-276
(3 sentences)

Stem-loop
   -u    a     ag         g    u 
5'   agcg gguau  aguuccuac ugug u
     |||| |||||  ||||||||| ||||  
3'   ucgu ccaua  ucaaggaug auau g
   uc    g     cu         -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lmi-miR-276-5p

Accession MIMAT0010138
Previous IDslmi-miR-276*
Sequence

2 - 

agcgagguauagaguuccuacg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lmi-miR-276-3p

Accession MIMAT0010139
Previous IDslmi-miR-276
Sequence

37 - 

uaggaacuucauaccgugcucu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1