Stem-loop sequence hsa-mir-548q

AccessionMI0010637 (change log)
Symbol HGNC:MIR548Q
DescriptionHomo sapiens miR-548q stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548q
(144 sentences)

Stem-loop
   auauu   c     c         g c g                 c  uu 
5'      agg uggug aaaaguaau g g uuuuugccauuacuuuu au  u
        ||| ||||| ||||||||| | | ||||||||||||||||| ||  u
3'      ucc accac uuuucauua u c aaaaacgguaaugaaaa ua  a
   -----   a     u         g a g                 u  cc 
Get sequence
Deep sequencing
4996 reads, 5.56 reads per million, 144 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 12725254-12725353 [-]
antisense
OTTHUMT00000046820 ; CAMK1D-001; intron 3
OTTHUMT00000046821 ; CAMK1D-002; intron 3
ENST00000378847 ; CAMK1D-001; intron 3
ENST00000378845 ; CAMK1D-002; intron 3
Database links

Mature sequence hsa-miR-548q

Accession MIMAT0011163
Sequence

8 - 

gcuggugcaaaaguaauggcgg

 - 29

Get sequence
Deep sequencing4879 reads, 146 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).