Stem-loop sequence hsa-mir-2115

Accession

MI0010634 (change log)

Symbol

HGNC:MIR2115

Description

Homo sapiens miR-2115 stem-loop

Literature search

5 open access papers mention hsa-mir-2115
(5 sentences)

Stem-loop

   acuguc    - --        c           cuc        ggaa  a 
5'       aucc c  acugcuuc agcuuccauga   cugaugga    uc c
         |||| |  |||||||| |||||||||||   ||||||||    ||  
3'       uagg g  ugacgaag ucggagguacu   gacuacuu    ag a
   auuuac    a ua        a           uaa        ---a  u 

Deep sequencing

514 reads, 1.43 reads per million, 70 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 48316360-48316459 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000346127 ; ZNF589-004; intron 3

  OTTHUMT00000346126 ; ZNF589-003; intron 3

  OTTHUMT00000346125 ; ZNF589-002; intron 4

  OTTHUMT00000346128 ; ZNF589-005; intron 4

  ENST00000427617 ; ZNF589-004; intron 3

  ENST00000412564 ; ZNF589-003; intron 3

  ENST00000440261 ; ZNF589-002; intron 4

  ENST00000448461 ; ZNF589-005; intron 4

Database links

• EntrezGene:MIR2115
• HGNC:MIR2115
• miRBase Tracker:MI0010634

Mature sequence hsa-miR-2115-5p

• Accession: MIMAT0011158
• Previous IDs: hsa-miR-2115
• Sequence: 21 - agcuuccaugacuccugaugga - 42
• Deep sequencing: 169 reads, 54 experiments
• Evidence: experimental; 454 [1], Illumina [2]
• Predicted targets:
  • TargetMiner:hsa-miR-2115-5p
  • TargetScanVert:hsa-miR-2115-5p
  • miRDB:hsa-miR-2115-5p
  • microrna.org:hsa-miR-2115-5p

Mature sequence hsa-miR-2115-3p

• Accession: MIMAT0011159
• Previous IDs: hsa-miR-2115*
• Sequence: 58 - caucagaauucauggaggcuag - 79
• Deep sequencing: 316 reads, 48 experiments
• Evidence: experimental; 454 [1], Illumina [2]
• Predicted targets:
  • TargetMiner:hsa-miR-2115-3p
  • TargetScanVert:hsa-miR-2115-3p
  • miRDB:hsa-miR-2115-3p
  • microrna.org:hsa-miR-2115-3p

References

1. PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).