Stem-loop sequence hsa-mir-2115

Accession MI0010634
Description Homo sapiens miR-2115 stem-loop
Stem-loop 
acuguc    - --        c           cuc        ggaa  a 
      aucc c  acugcuuc agcuuccauga   cugaugga    uc c
      |||| |  |||||||| |||||||||||   ||||||||    ||  
      uagg g  ugacgaag ucggagguacu   gacuacuu    ag a
auuuac    a ua        a           uaa        ---a  u
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 48357850-48357949 [-]
sense
OTTHUMT00000346123 ; SPINK8-001; intron 3
OTTHUMT00000346123 ; SPINK8-001; intron 3
OTTHUMT00000346123 ; SPINK8-001; intron 3
ENST00000434006 ; SPINK8-001; intron 3
ENST00000434006 ; SPINK8-001; intron 3
ENST00000434006 ; SPINK8-001; intron 3
Database links

Mature sequence hsa-miR-2115-5p

Accession MIMAT0011158
Previous IDs hsa-miR-2115
Sequence

21 -  

agcuuccaugacuccugaugga

 - 42

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; 454 [1], Solexa [2]
Predicted targets

Mature sequence hsa-miR-2115-3p

Accession MIMAT0011159
Previous IDs hsa-miR-2115*
Sequence

58 -  

caucagaauucauggaggcuag

 - 79

Get sequence
Evidence experimental; 454 [1], Solexa [2]
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).