Stem-loop sequence ath-MIR2111b

AccessionMI0010631 (change log)
DescriptionArabidopsis thaliana miR2111b stem-loop
Gene family MIPF0000754; MIR2111
Literature search

4 open access papers mention ath-MIR2111b
(12 sentences)

Stem-loop
      c   a  aa    aagaug   -  --a     -   u   c      u   c         u      ccaauuaa  a       au 
5' caa aac cg  gaag      aag gu   cuuga uga gaa ggguaa cug auccugagg uuaaaa        gc uauacau  g
   ||| ||| ||  ||||      ||| ||   ||||| ||| ||| |||||| ||| ||||||||| ||||||        || |||||||   
3' guu uug gc  uuuc      uuc ca   gaacu auu cuu uccauu gac uagggcucc aauuuu        ug auaugua  c
      -   -  aa    ----ga   a  aaa     c   c   c      u   a         u      --------  -       ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 400358-400524 [+]
intergenic
Database links

Mature sequence ath-miR2111b-5p

Accession MIMAT0011152
Previous IDsath-miR2111b
Sequence

45 - 

uaaucugcauccugagguuua

 - 65

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence ath-miR2111b-3p

Accession MIMAT0011153
Previous IDsath-miR2111b*
Sequence

107 - 

auccucgggauacaguuuacc

 - 127

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:19307293 "Computational and analytical framework for small RNA profiling by high-throughput sequencing" Fahlgren N, Sullivan CM, Kasschau KD, Chapman EJ, Cumbie JS, Montgomery TA, Gilbert SD, Dasenko M, Backman TW, Givan SA, Carrington JC RNA. 15:992-1002(2009).
2
PMID:19465578 "Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing" Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR Plant Physiol. 150:1541-1555(2009).
3
PMID:19854858 "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ Plant Physiol. 151:2120-2132(2009).