Stem-loop sequence ath-MIR2111a

AccessionMI0010630 (change log)
DescriptionArabidopsis thaliana miR2111a stem-loop
Gene family MIPF0000754; MIR2111
Literature search

4 open access papers mention ath-MIR2111a
(12 sentences)

Stem-loop
      ug   a      ---        c                    u     gcuuaauuuacgcaggaaauuuguaua 
5' cga  aug guauug   gugaggac ggguaaucugcauccugagg uuaaa                           c
   |||  ||| ||||||   |||||||| |||||||||||||||||||| |||||                            
3' gcu  ugc cauaac   cauucuug uccauuaggcguagggcucc gauuu                           g
      ca   a      auu        c                    u     uccauaugauuauguguaugcauauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 2854284-2854442 [+]
intergenic
Database links

Mature sequence ath-miR2111a-5p

Accession MIMAT0011150
Previous IDsath-miR2111a
Sequence

28 - 

uaaucugcauccugagguuua

 - 48

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence ath-miR2111a-3p

Accession MIMAT0011151
Previous IDsath-miR2111a*
Sequence

111 - 

guccucgggaugcggauuacc

 - 131

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:19307293 "Computational and analytical framework for small RNA profiling by high-throughput sequencing" Fahlgren N, Sullivan CM, Kasschau KD, Chapman EJ, Cumbie JS, Montgomery TA, Gilbert SD, Dasenko M, Backman TW, Givan SA, Carrington JC RNA. 15:992-1002(2009).
2
PMID:19465578 "Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing" Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR Plant Physiol. 150:1541-1555(2009).
3
PMID:19854858 "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ Plant Physiol. 151:2120-2132(2009).