|
miRBase |
|
Stem-loop sequence hsa-mir-2110 |
|||||
| Accession | MI0010629 | ||||
| Symbol | HGNC:MIR2110 | ||||
| Description | Homo sapiens miR-2110 stem-loop | ||||
| Gene family | MIPF0001399; mir-2110 | ||||
| Stem-loop |
uu c -- u g u caggggu ggggaaa ggccgc ugag ga gcg c ||||||| ||||||| |||||| |||| || ||| g guucuca cuccuuu cuggcg acuc uu ugu g cc u cc u g c |
||||
| Deep sequencing |
| ||||
| Comments |
Zhu et al. incorrectly referred to this sequence as mir-1309 in [1]. This sequence is unrelated to MIR1309 in plants. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-2110 |
|
| Accession | MIMAT0010133 |
| Sequence |
8 - uuggggaaacggccgcugagug - 29 |
| Deep sequencing | 361 reads, 27 experiments |
| Evidence | experimental; 454 [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:19144710
"Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
J Virol. 83:3333-3341(2009).
|