Stem-loop sequence ebv-mir-BART22

AccessionMI0010628 (change log)
DescriptionEpstein Barr virus miR-BART22 stem-loop
Stem-loop
          g         c   ag   -    -  u 
5' gucacag ugcuagacc ugg  uug aacc ag a
   ||||||| ||||||||| |||  ||| |||| || c
3' caguguu augaucugg acu  aac uugg uc c
          g         u   ga   a    c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 147161-147231 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART22
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART22

Accession MIMAT0010132
Sequence

43 - 

uuacaaagucauggucuaguagu

 - 65

Get sequence
Evidence experimental; RT-PCR [1], 454 [2], cloned [3], Northern [3]

References

1
PMID:19091858 "Comprehensive profiling of Epstein-Barr virus microRNAs in nasopharyngeal carcinoma" Cosmopoulos K, Pegtel M, Hawkins J, Moffett H, Novina C, Middeldorp J, Thorley-Lawson DA J Virol. 83:2357-2367(2009).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:19881953 "Modulation of LMP2A expression by a newly identified Epstein-Barr virus-encoded microRNA miR-BART22" Lung RW, Tong JH, Sung YM, Leung PS, Ng DC, Chau SL, Chan AW, Ng EK, Lo KW, To KF Neoplasia. 11:1174-1184(2009).